MMLV RNASE H MINUS FIRST-STRAND CDNA SYNTHESIS KIT

Referência: 13-10504-005


Não disponível

Enviar
Avise-me quando estiver disponível

ARMAZENAR A -20OC.

DESCRIÇÃO:
MMLV RNASE H MINUS FIRST-STRAND CDNA SYNTHESIS KIT É UM SISTEMA COMPLETO PARA SÍNTESE DA PRIMEIRA FITA DE MOLÉCULAS DE DNA COMPLEMENTAR (CDNA) A PARTIR DE RNA MENSAGEIRO (MRNA) OU RNA TOTAL. ESTE SISTEMA FOI OTIMIZADO PARA A AMPLIFICAÇÃO DE CDNA DE ATÉ APROXIMADAMENTE 13 KB.
A ENZIMA TRANSCRIPTASE REVERSA M-MLV RNASE MINUS É UMA VERSÃO MODIFICADA DA ENZIMA M-MLV APRESENTANDO MUTAÇÕES DE PONTO QUE REDUZEM A ATIVIDADE DE RNASE H E AUMENTAM A ESTABILIDADE TÉRMICA.
DEVIDO A REDUZIDA ATIVIDADE DE RNASE H, NÃO OCORRE A DEGRADAÇÃO DE MOLÉCULAS DE RNA DURANTE A ETAPA DE SÍNTESE DA PRIMEIRA FITA DE CDNA, RESULTANDO NA SÍNTESE DE UMA GRANDE QUANTIDADE DE MOLÉCULAS ?FULL-LENGTH? DE CDNA.
DEVIDO A AUMENTADA ESTABILIDADE TÉRMICA, A ENZIMA TRANSCRIPTASE REVERSA M-MLV RNASE MINUS PODE SER UTILIZADA NA SÍNTESE DE MOLÉCULAS DE CDNA EM ELEVADAS TEMPERATURAS (42 A 60OC), PROPORCIONANDO UM MAIOR RENDIMENTO DE MOLÉCULAS DE CDNA.
DEPENDENDO DA APLICAÇÃO DO CDNA, O USUÁRIO PODERÁ ESCOLHER ENTRE 2 TIPOS DE PRIMERS:
ANCHORED OLIGO(DT)20 PRIMER É UMA MISTURA DE 12 PRIMERS, CADA PRIMER CONSISTINDO DE UMA SEQUÊNCIA DE 20 BASES T SEGUIDOS POR 2 BASES ADICIONAIS REPRESENTADAS POR VN, AONDE V É DA, DC OU DG E N É DA, DC, DG OU DT. A "ANCORA" VN PERMITE A HIBRIDIZAÇÃO DOS PRIMERS SOMENTE NA EXTREMIDADE 3' DA CAUDA DE POLI-A DE MRNA, PROMOVENDO UMA SÍNTESE MAIS EFICIENTE DE MOLÉCULAS ?FULL-LENGTH? DE CDNA.
É O MÉTODO DE ESCOLHA PARA GERAÇÃO DE CDNA PARA EXPERIMENTOS DE ANÁLISE DA EXPRESSÃO GÊNICA POR RT-QPCR DEVIDO A CONSISTÊNCIA DOS RESULTADOS.
RANDOM HEXAMER PRIMER É UMA MISTURA DE PRIMERS DE SEQUÊNCIA RANDÔMICA CONSISTINDO DE UMA SEQUÊNCIA DE 6 BASES N, AONDE N É DA, DC, DG OU DT. DEVIDO A HIBRIDIZAÇÃO DESTE PRIMER EM VÁRIAS SEQUÊNCIAS AO LONGO DA MOLÉCULA DE RNA, TEREMOS UMA REPRESENTAÇÃO UNIFORME DE TODAS AS MOLÉCULAS DE RNA.
SÃO UTILIZADOS NA GERAÇÃO DE CDNA A PARTIR DE RNAS QUE NÃO POSSUEM CAUDA POLI-A.
DESTA FORMA, A SÍNTESE DO CDNA PODE SER REALIZADA A PARTIR DE MRNA POLI-A+ OU RNA TOTAL.
NA PRÓXIMA ETAPA, A REAÇÃO DE PCR É REALIZADA UTILIZANDO PRIMERS ESPECÍFICOS PARA OS GENES DE INTERESSE.
NESTE CASO, RECOMENDAMOS O USO DOS SEGUINTES PRODUTOS:         TAQ DNA POLIMERASE, HOT START TAQ DNA POLIMERASE,     SYBR GREEN QPCR MASTER MIX, EVAGREEN QPCR MASTER MIX OU PROBE QPCR MASTER MIX
COMPONENTES DO KIT PARA 50 REAÇÕES

CÓD.. NO.

13-10504-005     

50 REAÇÕES
(20µL)

50 µL

TRANSCRIPTASE REVERSA M-MLV RNASE MINUS 200 UNIDADES / µL

TAMPA VERMELHA

200 µL

5X TAMPÃO DE REAÇÃO FIRST-STRAND CDNA

TAMPA TRANSPARENTE

100 µL

10MM DNTP MIX

TAMPA BRANCA

50 µL

ANCHORED OLIGO(DT)20PRIMER 50 µM

TAMPA AMARELA

50 µL

RANDOM HEXAMER PRIMER 100 µM

TAMPA VERDE

1000 µL

ÁGUA RNASE-FREE

TAMPA TRANSPARENTE

 
NOTA IMPORTANTE:EVITE A CONTAMINAÇÃO POR RIBONUCLEASES
A PUREZA E INTEGRIDADE DO RNA É ESSENCIAL PARA A SÍNTESE DE MOLÉCULAS ?FULL-LENGTH? DE CDNA. COMO FORMA DE PREVENÇÃO PARA EVITAR A CONTAMINAÇÃO POR RIBONUCLEASES, RECOMENDAMOS O USO DE MATERIAIS PLÁSTICOS COMO MICROTUBOS E PONTEIRAS COM CERTIFICAÇÃO RNASE-FREE.      USO DE ÁGUA PARA BIOLOGIA MOLECULAR COM ALTO GRAU DE PUREZA LIVRE DE RNASES. USO DE LUVAS DURANTE A MANIPULAÇÃO DAS AMOSTRAS POIS A PELE HUMANA É UMA FONTE DE RNASES. USO DO INIBIDOR DE RNASE INCLUSO NO KIT PARA PROTEGER O RNA DA ATIVIDADE DE RNASES.
INSTRUÇÕES PARA USO
1. DESCONGELAR, MISTURAR E CENTRIFUGAR RAPIDAMENTE TODOS OS COMPONENTES ANTES DO USO. MANTER OS REAGENTES NO GELO.
2. ADICIONAR OS SEGUINTES REAGENTES EM UM MICROTUBO RNASE-FREE MANTIDO NO GELO: 

COMPONENTES

QUANTIDADE

1 PG A    5 µG DE RNA TOTAL
1 PG A 0,5 µG DE MRNA POLI-A+

X  µL

ANCHORED OLIGO(DT)20 PRIMER
OU
RANDOM HEXAMER PRIMER
OU
2 µM  PRIMER GENE-ESPECÍFICO

1  µL

ÁGUA RNASE-FREE

COMPLETAR O VOLUME PARA 10 µL

 

 

 

 

 

 

 

 

3. INCUBAR OS MICROTUBOS A 65OC DURANTE 5 MINUTOS.

4. MANTER OS MICROTUBOS NO GELO POR, PELO MENOS,                  1 MINUTO.
5. PREPARAR A SEGUINTE MISTURA DE SÍNTESE DE CDNA, ADICIONANDO OS COMPONENTES NA SEGUINTE ORDEM:
  

COMPONENTES

1 REAÇÃO

10 REAÇÕES

5X TAMPÃO DE REAÇÃO FIRST-STRAND CDNA

4 µL

40 µL

10MM DNTP MIX

2 µL

20 µL

TRANSCRIPTASE REVERSA M-MLV RNASE MINUS 200 UNIDADES / µL

1 µL

10 µL

ÁGUA RNASE-FREE

3 µL

30 µL

VOLUME

10 µL

100 µL

 
6. ADICIONAR 10 µL DA MISTURA DE SÍNTESE DE CDNA EM CADA MICROTUBO CONTENDO O RNA ALVO E PRIMER.
VOLUME TOTAL DA REAÇÃO DE SÍNTESE DE CDNA: 20 µL
7. MISTURAR A SOLUÇÃO DOS MICROTUBOS ATRAVÉS DE PROCEDIMENTO DE PIPETAGEM.
8. INCUBAR OS MICROTUBOS DE ACORDO COM O PRIMER UTILIZADO PARA SÍNTESE DO CDNA:
ANCHORED OLIGO(DT)20 PRIMER            60 MINUTOS A 50OC*
PRIMER GENE-ESPECÍFICO                     60 MINUTOS A 50OC
RANDOM HEXAMER PRIMER                 10 MINUTOS A 25OC                                       SEGUIDO POR 60 MINUTOS A 50OC
 
* PARA ALVOS DE MRNA COM ALTO CONTEÚDO DE BASES GC, RECOMENDAMOS A REALIZAÇÃO DA REAÇÃO DE TRANSCRIÇÃO REVERSA INCUBANDO OS MICROTUBOS DURANTE 60 MINUTOS A 55OC OU 60OC.
9. INCUBAR OS MICROTUBOS POR 5 MINUTOS A 85OC PARA INATIVAR A REAÇÃO.
10. MANTER OS MICROTUBOS NO GELO.
A MISTURA DE SÍNTESE DE CDNA PODE SER ARMAZENADA A             -20OC OU UTILIZADA IMEDIATAMENTE EM REAÇÕES DE PCR E PCR EM TEMPO REAL.
PARA REAÇÕES DE PCR, UTILIZAR 1 A 5 µL DA MISTURA DE SÍNTESE DE CDNA COMO ALVO.
CONTROLE DE QUALIDADE
CADA LOTE DESTE PRODUTO É AVALIADO EM REAÇÕES DE PCR E QPCR EM TEMPO REAL EM UM TERMOCICLADOR ABI 7500 REAL-TIME PCR SYSTEM SEGUINDO O PROTOCOLO DESCRITO A SEGUIR UTILIZANDO 5 µL DO CDNA SINTETIZADO PELO MMLV RNASE H MINUS FIRST-STRAND CDNA SYNTHESIS KIT A PARTIR DE 1 µG DE RNA TOTAL PURIFICADO POR RNAZOL RT:
REAÇÃO DE PCR
PROTOCOLO REALIZADO SEGUINDO O MANUAL DO PRODUTO           TAQ DNA POLIMERASE UTILIZANDO OS SEGUINTES COMPONENTES DA REAÇÃO DE PCR:

COMPONENTE DA REAÇÃO DE PCR

VOLUME

CONCENTRAÇÃO FINAL

ÁGUA PARA BIOLOGIA MOLECULAR

33,75 µL

 

10X TAMPÃO DE REAÇÃO 15 MM DE MGCL2

5 µL

1X

10 MM DNTP MIX

1 µL

0,2 MM

10 µM PRIMER FORWARD
GAPDH                                5? CAAGGTCATCCATGACAACTTG 3?

2,5 µL

0,5 µM

10 µM PRIMER REVERSE
GAPDH                                5? GTCCACCACCCTGTTGCTGTAG 3?

2,5 µL

0,5 µM

TAQ DNA POLIMERASE 5U/µL

0,25 µL

1,25 U

CDNA

5UL

 

VOLUME TOTAL

50 UL

 

 
A REAÇÃO DE PCR FOI REALIZADA CONFORME AS SEGUINTES CONDIÇÕES DE CICLAGEM TÉRMICA:

 

TEMP

TEMPO

CICLOS

DENATURAÇÃO INICIAL

95OC

3 MINUTOS

 

DESNATURAÇÃO

95OC

30 SEGUNDOS

35 CICLOS

PAREAMENTO

58OC

30 SEGUNDOS

EXTENSÃO

72OC

45 SEGUNDOS

EXTENSÃO FINAL

72OC

10 MINUTOS

 

 
A ANÁLISE DA REAÇÃO DE PCR EM UM GEL DE AGAROSE 2% DEVERÁ DEMONSTRAR A PRESENÇA DE UMA FORTE BANDA CORRESPONDENTE A UM PRODUTO DE PCR DE 496 PARES DE BASES DO GENE GAPDH HUMANO.
PCR QUANTITATIVO EM TEMPO REAL
PROTOCOLO REALIZADO SEGUINDO O MANUAL DO PRODUTO           PROBE QPCR MASTER MIX UTILIZANDO OS SEGUINTES COMPONENTES DA REAÇÃO DE QPCR:

COMPONENTES

VOLUME

CONCENTRAÇÃO FINAL

2X TAMPÃO DE REAÇÃO QPCR LOW ROX

12,5 µL

1X

20 µM PRIMER DIRETO
RNASE P
5- AGA TTT GGA CCT GCG AGC G&

Deixe seu comentário e sua avaliação







- Máximo de 512 caracteres.

Clique para Avaliar


  • Avaliação:
Enviar
Faça seu login e comente.

Características